Transfection:Article Title: TRPML1 gating modulation by allosteric mutations and lipids (Design of allosteric mutations that recapitulate the gating of TRPML1)
Article Snippet: .. Reagent type (species) or resource Designation Source or reference Identifiers Additional information Strain, strain background (Escherichia coli) TOP10 Thermo Fisher Scientific Cat# 18258012 Strain, strain background (E. coli) DH10bac Thermo Fisher Scientific Cat# 10361012 Cell line (Spodoptera frugiperda) Sf9 cells Thermo Fisher Scientific Cat# 11496015; RRID:CVCL_0549 Cell line (Homo sapiens) FreeStyle 293 F cells Thermo Fisher Scientific Cat# R79007; RRID:CVCL_D603 Transfected construct (H. sapiens) pEZT- BM- mTRPML1- CHis This paper N/A Construct made to express the protein in HEK293F cells Recombinant DNA reagent pEZT- BM DOI:10.1016 /j. str.2016.03.004 Addgene:74099 Sequence- based reagent Mcoln1_F_primer: cgCTCGAG gccgccaccATGGCC ACCCCGGCGGGC Integrated DNA Technologies N/A Sequence- based reagent Mcoln1_R_primer: at gcggccgcTCAGTTC ACCAGCAGCGA Integrated DNA Technologies N/A Sequence- based reagent Mcoln1_Y404A_F_primer: cttgtggaaaaatgtcaggg cgcgaatgacaccgacccag Integrated DNA Technologies N/A Sequence- based reagent Mcoln1_Y404A_R_primer: ctgggtcggtgtcattcgcg ccctgacatttttccacaag Integrated DNA Technologies N/A Sequence- based reagent Mcoln1_Y404W_F_primer: cttgtggaaaaatgtcag ccagcgaatgacaccgaccc Integrated DNA Technologies N/A Sequence- based reagent Mcoln1_Y404W_R_primer: gggtcggtgtcattcgctg gctgacatttttccacaag Integrated DNA Technologies N/A Chemical compound, drug Sodium Butyrate Sigma- Aldrich Cat# 303410 Chemical compound, drug n- dodecyl-β-D- maltopyranoside Anatrace Cat# D310 Chemical compound, drug glyco- diosgenin Anatrace Cat# GDN101 Chemical compound, drug ML- SA1 Sigma- Aldrich Cat# SML0627 Chemical compound, drug ML- SI1 Medchemexpress Cat# HY- 134818 Chemical compound, drug PI(4,5)P2 diC8 Echelon Cat# P- 4508 Chemical compound, drug Sphingomyelin Sigma- Aldrich Cat# 567706 Chemical compound, drug Temsirolimus Fisher Scientific Cat# 52- 641- 0 Chemical compound, drug ML- SI3 Selleckchem Cat# E0026 Chemical compound, drug SF- 51 Chemspace Cat# CSSS00121681914 Chemical compound, drug Thrombin Sigma- Aldrich Cat# T4648 Gan et al. eLife 2024;13:RP100987. .. DOI: https://doi.org/10.7554/eLife.100987 9 of 16 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Software, algorithm MotionCor2 Zheng et al., 2017 https://emcore.ucsf.edu/ucsf-software Software, algorithm GCTF Zhang, 2016; JackZhangLab, 2021b https://github.com/JackZhang-Lab/GCTF Software, algorithm RELION Scheres, 2012 http://www2.mrc-lmb.cam.ac.uk/relion Software, algorithm Chimera Pettersen et al., 2004 RRID:SCR_004097 https://www.cgl.ucsf.edu/chimera Software, algorithm PyMol Schrödinger RRID:SCR_000305 https://pymol.org/2 Software, algorithm COOT Emsley et al., 2010 RRID:SCR_014222 https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/ coot Software, algorithm MolProbity Chen et al., 2010 http://molprobity.biochem.duke.edu/ Software, algorithm PHENIX Adams et al., 2010 https://www.phenix-online.org Other Superose 6 Increase10/300 GL GE Healthcare Cat# 29091596 Used to perform gel filtration Other Ni- NTA Agarose Qiagen Cat# 30210 Used to purify His- tagged protein Other Amicon Ultra- 15 Centrifugal Filter Units Milliporesigma Cat# UFC9100 Used to concentrate protein sample Other Quantifoil R 1.2/1.3 grid Au300 Quantifoil Cat# Q37572 Used to prepare cryoEM samples Commercial assay or kit Cellfectin Thermo Fisher Scientific Cat# 10362100 Other Sf- 900 II SFM medium Thermo Fisher Scientific Cat# 10902088 Used to culture SF9 cells Other FreeStyle 293 Expression Medium Thermo Fisher Scientific Cat# 12338018 Used to culture HEK293F cells Chemical compound, drug Antibiotic Antimycotic Solution Sigma- Aldrich Cat# A5955 Chemical compound, drug Proteinase K Thermo Fisher Scientific Cat# EO0491 Commercial assay or kit Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668027 Continued
Construct:Article Title: TRPML1 gating modulation by allosteric mutations and lipids (Design of allosteric mutations that recapitulate the gating of TRPML1)
Article Snippet: .. Reagent type (species) or resource Designation Source or reference Identifiers Additional information Strain, strain background (Escherichia coli) TOP10 Thermo Fisher Scientific Cat# 18258012 Strain, strain background (E. coli) DH10bac Thermo Fisher Scientific Cat# 10361012 Cell line (Spodoptera frugiperda) Sf9 cells Thermo Fisher Scientific Cat# 11496015; RRID:CVCL_0549 Cell line (Homo sapiens) FreeStyle 293 F cells Thermo Fisher Scientific Cat# R79007; RRID:CVCL_D603 Transfected construct (H. sapiens) pEZT- BM- mTRPML1- CHis This paper N/A Construct made to express the protein in HEK293F cells Recombinant DNA reagent pEZT- BM DOI:10.1016 /j. str.2016.03.004 Addgene:74099 Sequence- based reagent Mcoln1_F_primer: cgCTCGAG gccgccaccATGGCC ACCCCGGCGGGC Integrated DNA Technologies N/A Sequence- based reagent Mcoln1_R_primer: at gcggccgcTCAGTTC ACCAGCAGCGA Integrated DNA Technologies N/A Sequence- based reagent Mcoln1_Y404A_F_primer: cttgtggaaaaatgtcaggg cgcgaatgacaccgacccag Integrated DNA Technologies N/A Sequence- based reagent Mcoln1_Y404A_R_primer: ctgggtcggtgtcattcgcg ccctgacatttttccacaag Integrated DNA Technologies N/A Sequence- based reagent Mcoln1_Y404W_F_primer: cttgtggaaaaatgtcag ccagcgaatgacaccgaccc Integrated DNA Technologies N/A Sequence- based reagent Mcoln1_Y404W_R_primer: gggtcggtgtcattcgctg gctgacatttttccacaag Integrated DNA Technologies N/A Chemical compound, drug Sodium Butyrate Sigma- Aldrich Cat# 303410 Chemical compound, drug n- dodecyl-β-D- maltopyranoside Anatrace Cat# D310 Chemical compound, drug glyco- diosgenin Anatrace Cat# GDN101 Chemical compound, drug ML- SA1 Sigma- Aldrich Cat# SML0627 Chemical compound, drug ML- SI1 Medchemexpress Cat# HY- 134818 Chemical compound, drug PI(4,5)P2 diC8 Echelon Cat# P- 4508 Chemical compound, drug Sphingomyelin Sigma- Aldrich Cat# 567706 Chemical compound, drug Temsirolimus Fisher Scientific Cat# 52- 641- 0 Chemical compound, drug ML- SI3 Selleckchem Cat# E0026 Chemical compound, drug SF- 51 Chemspace Cat# CSSS00121681914 Chemical compound, drug Thrombin Sigma- Aldrich Cat# T4648 Gan et al. eLife 2024;13:RP100987. .. DOI: https://doi.org/10.7554/eLife.100987 9 of 16 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Software, algorithm MotionCor2 Zheng et al., 2017 https://emcore.ucsf.edu/ucsf-software Software, algorithm GCTF Zhang, 2016; JackZhangLab, 2021b https://github.com/JackZhang-Lab/GCTF Software, algorithm RELION Scheres, 2012 http://www2.mrc-lmb.cam.ac.uk/relion Software, algorithm Chimera Pettersen et al., 2004 RRID:SCR_004097 https://www.cgl.ucsf.edu/chimera Software, algorithm PyMol Schrödinger RRID:SCR_000305 https://pymol.org/2 Software, algorithm COOT Emsley et al., 2010 RRID:SCR_014222 https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/ coot Software, algorithm MolProbity Chen et al., 2010 http://molprobity.biochem.duke.edu/ Software, algorithm PHENIX Adams et al., 2010 https://www.phenix-online.org Other Superose 6 Increase10/300 GL GE Healthcare Cat# 29091596 Used to perform gel filtration Other Ni- NTA Agarose Qiagen Cat# 30210 Used to purify His- tagged protein Other Amicon Ultra- 15 Centrifugal Filter Units Milliporesigma Cat# UFC9100 Used to concentrate protein sample Other Quantifoil R 1.2/1.3 grid Au300 Quantifoil Cat# Q37572 Used to prepare cryoEM samples Commercial assay or kit Cellfectin Thermo Fisher Scientific Cat# 10362100 Other Sf- 900 II SFM medium Thermo Fisher Scientific Cat# 10902088 Used to culture SF9 cells Other FreeStyle 293 Expression Medium Thermo Fisher Scientific Cat# 12338018 Used to culture HEK293F cells Chemical compound, drug Antibiotic Antimycotic Solution Sigma- Aldrich Cat# A5955 Chemical compound, drug Proteinase K Thermo Fisher Scientific Cat# EO0491 Commercial assay or kit Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668027 Continued
Recombinant:Article Title: TRPML1 gating modulation by allosteric mutations and lipids (Design of allosteric mutations that recapitulate the gating of TRPML1)
Article Snippet: .. Reagent type (species) or resource Designation Source or reference Identifiers Additional information Strain, strain background (Escherichia coli) TOP10 Thermo Fisher Scientific Cat# 18258012 Strain, strain background (E. coli) DH10bac Thermo Fisher Scientific Cat# 10361012 Cell line (Spodoptera frugiperda) Sf9 cells Thermo Fisher Scientific Cat# 11496015; RRID:CVCL_0549 Cell line (Homo sapiens) FreeStyle 293 F cells Thermo Fisher Scientific Cat# R79007; RRID:CVCL_D603 Transfected construct (H. sapiens) pEZT- BM- mTRPML1- CHis This paper N/A Construct made to express the protein in HEK293F cells Recombinant DNA reagent pEZT- BM DOI:10.1016 /j. str.2016.03.004 Addgene:74099 Sequence- based reagent Mcoln1_F_primer: cgCTCGAG gccgccaccATGGCC ACCCCGGCGGGC Integrated DNA Technologies N/A Sequence- based reagent Mcoln1_R_primer: at gcggccgcTCAGTTC ACCAGCAGCGA Integrated DNA Technologies N/A Sequence- based reagent Mcoln1_Y404A_F_primer: cttgtggaaaaatgtcaggg cgcgaatgacaccgacccag Integrated DNA Technologies N/A Sequence- based reagent Mcoln1_Y404A_R_primer: ctgggtcggtgtcattcgcg ccctgacatttttccacaag Integrated DNA Technologies N/A Sequence- based reagent Mcoln1_Y404W_F_primer: cttgtggaaaaatgtcag ccagcgaatgacaccgaccc Integrated DNA Technologies N/A Sequence- based reagent Mcoln1_Y404W_R_primer: gggtcggtgtcattcgctg gctgacatttttccacaag Integrated DNA Technologies N/A Chemical compound, drug Sodium Butyrate Sigma- Aldrich Cat# 303410 Chemical compound, drug n- dodecyl-β-D- maltopyranoside Anatrace Cat# D310 Chemical compound, drug glyco- diosgenin Anatrace Cat# GDN101 Chemical compound, drug ML- SA1 Sigma- Aldrich Cat# SML0627 Chemical compound, drug ML- SI1 Medchemexpress Cat# HY- 134818 Chemical compound, drug PI(4,5)P2 diC8 Echelon Cat# P- 4508 Chemical compound, drug Sphingomyelin Sigma- Aldrich Cat# 567706 Chemical compound, drug Temsirolimus Fisher Scientific Cat# 52- 641- 0 Chemical compound, drug ML- SI3 Selleckchem Cat# E0026 Chemical compound, drug SF- 51 Chemspace Cat# CSSS00121681914 Chemical compound, drug Thrombin Sigma- Aldrich Cat# T4648 Gan et al. eLife 2024;13:RP100987. .. DOI: https://doi.org/10.7554/eLife.100987 9 of 16 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Software, algorithm MotionCor2 Zheng et al., 2017 https://emcore.ucsf.edu/ucsf-software Software, algorithm GCTF Zhang, 2016; JackZhangLab, 2021b https://github.com/JackZhang-Lab/GCTF Software, algorithm RELION Scheres, 2012 http://www2.mrc-lmb.cam.ac.uk/relion Software, algorithm Chimera Pettersen et al., 2004 RRID:SCR_004097 https://www.cgl.ucsf.edu/chimera Software, algorithm PyMol Schrödinger RRID:SCR_000305 https://pymol.org/2 Software, algorithm COOT Emsley et al., 2010 RRID:SCR_014222 https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/ coot Software, algorithm MolProbity Chen et al., 2010 http://molprobity.biochem.duke.edu/ Software, algorithm PHENIX Adams et al., 2010 https://www.phenix-online.org Other Superose 6 Increase10/300 GL GE Healthcare Cat# 29091596 Used to perform gel filtration Other Ni- NTA Agarose Qiagen Cat# 30210 Used to purify His- tagged protein Other Amicon Ultra- 15 Centrifugal Filter Units Milliporesigma Cat# UFC9100 Used to concentrate protein sample Other Quantifoil R 1.2/1.3 grid Au300 Quantifoil Cat# Q37572 Used to prepare cryoEM samples Commercial assay or kit Cellfectin Thermo Fisher Scientific Cat# 10362100 Other Sf- 900 II SFM medium Thermo Fisher Scientific Cat# 10902088 Used to culture SF9 cells Other FreeStyle 293 Expression Medium Thermo Fisher Scientific Cat# 12338018 Used to culture HEK293F cells Chemical compound, drug Antibiotic Antimycotic Solution Sigma- Aldrich Cat# A5955 Chemical compound, drug Proteinase K Thermo Fisher Scientific Cat# EO0491 Commercial assay or kit Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668027 Continued
Sequencing:Article Title: TRPML1 gating modulation by allosteric mutations and lipids (Design of allosteric mutations that recapitulate the gating of TRPML1)
Article Snippet: .. Reagent type (species) or resource Designation Source or reference Identifiers Additional information Strain, strain background (Escherichia coli) TOP10 Thermo Fisher Scientific Cat# 18258012 Strain, strain background (E. coli) DH10bac Thermo Fisher Scientific Cat# 10361012 Cell line (Spodoptera frugiperda) Sf9 cells Thermo Fisher Scientific Cat# 11496015; RRID:CVCL_0549 Cell line (Homo sapiens) FreeStyle 293 F cells Thermo Fisher Scientific Cat# R79007; RRID:CVCL_D603 Transfected construct (H. sapiens) pEZT- BM- mTRPML1- CHis This paper N/A Construct made to express the protein in HEK293F cells Recombinant DNA reagent pEZT- BM DOI:10.1016 /j. str.2016.03.004 Addgene:74099 Sequence- based reagent Mcoln1_F_primer: cgCTCGAG gccgccaccATGGCC ACCCCGGCGGGC Integrated DNA Technologies N/A Sequence- based reagent Mcoln1_R_primer: at gcggccgcTCAGTTC ACCAGCAGCGA Integrated DNA Technologies N/A Sequence- based reagent Mcoln1_Y404A_F_primer: cttgtggaaaaatgtcaggg cgcgaatgacaccgacccag Integrated DNA Technologies N/A Sequence- based reagent Mcoln1_Y404A_R_primer: ctgggtcggtgtcattcgcg ccctgacatttttccacaag Integrated DNA Technologies N/A Sequence- based reagent Mcoln1_Y404W_F_primer: cttgtggaaaaatgtcag ccagcgaatgacaccgaccc Integrated DNA Technologies N/A Sequence- based reagent Mcoln1_Y404W_R_primer: gggtcggtgtcattcgctg gctgacatttttccacaag Integrated DNA Technologies N/A Chemical compound, drug Sodium Butyrate Sigma- Aldrich Cat# 303410 Chemical compound, drug n- dodecyl-β-D- maltopyranoside Anatrace Cat# D310 Chemical compound, drug glyco- diosgenin Anatrace Cat# GDN101 Chemical compound, drug ML- SA1 Sigma- Aldrich Cat# SML0627 Chemical compound, drug ML- SI1 Medchemexpress Cat# HY- 134818 Chemical compound, drug PI(4,5)P2 diC8 Echelon Cat# P- 4508 Chemical compound, drug Sphingomyelin Sigma- Aldrich Cat# 567706 Chemical compound, drug Temsirolimus Fisher Scientific Cat# 52- 641- 0 Chemical compound, drug ML- SI3 Selleckchem Cat# E0026 Chemical compound, drug SF- 51 Chemspace Cat# CSSS00121681914 Chemical compound, drug Thrombin Sigma- Aldrich Cat# T4648 Gan et al. eLife 2024;13:RP100987. .. DOI: https://doi.org/10.7554/eLife.100987 9 of 16 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Software, algorithm MotionCor2 Zheng et al., 2017 https://emcore.ucsf.edu/ucsf-software Software, algorithm GCTF Zhang, 2016; JackZhangLab, 2021b https://github.com/JackZhang-Lab/GCTF Software, algorithm RELION Scheres, 2012 http://www2.mrc-lmb.cam.ac.uk/relion Software, algorithm Chimera Pettersen et al., 2004 RRID:SCR_004097 https://www.cgl.ucsf.edu/chimera Software, algorithm PyMol Schrödinger RRID:SCR_000305 https://pymol.org/2 Software, algorithm COOT Emsley et al., 2010 RRID:SCR_014222 https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/ coot Software, algorithm MolProbity Chen et al., 2010 http://molprobity.biochem.duke.edu/ Software, algorithm PHENIX Adams et al., 2010 https://www.phenix-online.org Other Superose 6 Increase10/300 GL GE Healthcare Cat# 29091596 Used to perform gel filtration Other Ni- NTA Agarose Qiagen Cat# 30210 Used to purify His- tagged protein Other Amicon Ultra- 15 Centrifugal Filter Units Milliporesigma Cat# UFC9100 Used to concentrate protein sample Other Quantifoil R 1.2/1.3 grid Au300 Quantifoil Cat# Q37572 Used to prepare cryoEM samples Commercial assay or kit Cellfectin Thermo Fisher Scientific Cat# 10362100 Other Sf- 900 II SFM medium Thermo Fisher Scientific Cat# 10902088 Used to culture SF9 cells Other FreeStyle 293 Expression Medium Thermo Fisher Scientific Cat# 12338018 Used to culture HEK293F cells Chemical compound, drug Antibiotic Antimycotic Solution Sigma- Aldrich Cat# A5955 Chemical compound, drug Proteinase K Thermo Fisher Scientific Cat# EO0491 Commercial assay or kit Lipofectamine 2000 Thermo Fisher Scientific Cat# 11668027 Continued
|
Addgene inc is a verified supplier 